ID: 969157639_969157653

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 969157639 969157653
Species Human (GRCh38) Human (GRCh38)
Location 4:5225545-5225567 4:5225596-5225618
Sequence CCCGTCTTTATCTTCTGGTTGGG TGACAGGTTCAGAACCTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 411} {0: 1, 1: 0, 2: 0, 3: 8, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!