|
Left Crispr |
Right Crispr |
| Crispr ID |
969159539 |
969159544 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:5244198-5244220
|
4:5244243-5244265
|
| Sequence |
CCATCTGGTCCTGGACTTTTTTT |
CAATTTCAGAGCCTGTTTATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3205, 1: 6922, 2: 3398, 3: 2434, 4: 2909} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|