ID: 969160561_969160565

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 969160561 969160565
Species Human (GRCh38) Human (GRCh38)
Location 4:5254078-5254100 4:5254130-5254152
Sequence CCCAGCTGAATCTTTTTTTGTAG GCCTATGTTAGCTTTCGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 160, 4: 1438} {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!