ID: 969177778_969177785

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 969177778 969177785
Species Human (GRCh38) Human (GRCh38)
Location 4:5412358-5412380 4:5412391-5412413
Sequence CCCATTAGATGAGGCCCACTGGG TCATCAGTTAGCATAGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92} {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!