ID: 969178823_969178829

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 969178823 969178829
Species Human (GRCh38) Human (GRCh38)
Location 4:5421683-5421705 4:5421708-5421730
Sequence CCAGGAAAGCAGAGCCATGGGGA CAGCTGGGCACTCTCCTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 450} {0: 1, 1: 0, 2: 0, 3: 28, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!