ID: 969180618_969180622

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 969180618 969180622
Species Human (GRCh38) Human (GRCh38)
Location 4:5437809-5437831 4:5437833-5437855
Sequence CCTTCCAGCTCTAAACCTGTGTA TTCTCTCACGTCTAAGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 328} {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!