ID: 969182400_969182413

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 969182400 969182413
Species Human (GRCh38) Human (GRCh38)
Location 4:5452212-5452234 4:5452264-5452286
Sequence CCCCAGTCAGCACTTCTCCTTAG CAGAGAGGCCAGCGAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 159} {0: 1, 1: 1, 2: 3, 3: 40, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!