ID: 969199514_969199528

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 969199514 969199528
Species Human (GRCh38) Human (GRCh38)
Location 4:5591457-5591479 4:5591509-5591531
Sequence CCCCTCTTGGGTGGGTGGGTGGT CTGCAGAGGTGCAGAGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 246} {0: 1, 1: 0, 2: 5, 3: 52, 4: 505}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!