ID: 969199611_969199614

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 969199611 969199614
Species Human (GRCh38) Human (GRCh38)
Location 4:5592390-5592412 4:5592435-5592457
Sequence CCAGTGGCAAAAGAGGCATTGAG GTAACTAGTCAGATGTGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 143} {0: 1, 1: 0, 2: 19, 3: 103, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!