ID: 969210656_969210662

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 969210656 969210662
Species Human (GRCh38) Human (GRCh38)
Location 4:5684738-5684760 4:5684767-5684789
Sequence CCCTAGGATGGTGACTGCATTTG GGGTCTTTACAGAGGTAGTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 34, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!