ID: 969215787_969215789

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 969215787 969215789
Species Human (GRCh38) Human (GRCh38)
Location 4:5721263-5721285 4:5721292-5721314
Sequence CCAAATAGAAAAACTGGAAAAAT TGATATATGCAGACATTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 120, 4: 1201} {0: 1, 1: 0, 2: 1, 3: 14, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!