ID: 969220174_969220186

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 969220174 969220186
Species Human (GRCh38) Human (GRCh38)
Location 4:5754060-5754082 4:5754102-5754124
Sequence CCGAGTGACCGAATCTCAGTCCC GGTCCTAGTGGACTGTAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76} {0: 1, 1: 0, 2: 1, 3: 7, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!