ID: 969220233_969220245

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 969220233 969220245
Species Human (GRCh38) Human (GRCh38)
Location 4:5754340-5754362 4:5754381-5754403
Sequence CCAGGAGAAGGAAGGGAGTTCCC GAGTGGTCAGGGCCAGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 298} {0: 1, 1: 0, 2: 7, 3: 81, 4: 585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!