ID: 969227764_969227774

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 969227764 969227774
Species Human (GRCh38) Human (GRCh38)
Location 4:5810346-5810368 4:5810374-5810396
Sequence CCTAAGGACTAAAAGGAAGAAGC CCCCAGGAAAGAGGGGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 251} {0: 1, 1: 0, 2: 5, 3: 36, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!