ID: 969233809_969233811

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 969233809 969233811
Species Human (GRCh38) Human (GRCh38)
Location 4:5851199-5851221 4:5851225-5851247
Sequence CCTTCTGCATGCCACTCACACAG GAAAAGAACAGAAGCCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 288} {0: 1, 1: 0, 2: 6, 3: 43, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!