ID: 969241906_969241914

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 969241906 969241914
Species Human (GRCh38) Human (GRCh38)
Location 4:5904495-5904517 4:5904535-5904557
Sequence CCTCAGTAGGAACTCAGCCACTG CATTTTACAGATAAGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!