ID: 969244323_969244338

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 969244323 969244338
Species Human (GRCh38) Human (GRCh38)
Location 4:5922683-5922705 4:5922736-5922758
Sequence CCCTCCAGCTCCTGCATCCATGG ATGCTCATCAAATGGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 29, 4: 323} {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!