ID: 969274462_969274474

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 969274462 969274474
Species Human (GRCh38) Human (GRCh38)
Location 4:6125390-6125412 4:6125436-6125458
Sequence CCCAATGCCACTCTCCCAGCTCC CTGTCAGGACTTCCTGTTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!