ID: 969278100_969278105

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 969278100 969278105
Species Human (GRCh38) Human (GRCh38)
Location 4:6150540-6150562 4:6150555-6150577
Sequence CCGCTTCTTAATCCCTGCCTCGG TGCCTCGGAGGCAGCTCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!