ID: 969286574_969286578

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 969286574 969286578
Species Human (GRCh38) Human (GRCh38)
Location 4:6206201-6206223 4:6206234-6206256
Sequence CCAGTGAACAGCAGCATGAAGGC GATTTGACCTTCCACTTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 172} {0: 1, 1: 0, 2: 0, 3: 15, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!