ID: 969289925_969289932

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 969289925 969289932
Species Human (GRCh38) Human (GRCh38)
Location 4:6232120-6232142 4:6232157-6232179
Sequence CCTGCGGCCTTCTCCTTATTTGG ATTGTCGTCATGCAAAAACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!