ID: 969295640_969295655

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 969295640 969295655
Species Human (GRCh38) Human (GRCh38)
Location 4:6269534-6269556 4:6269582-6269604
Sequence CCACCTGTTACAGGAGAAGGCGA TCCGCGGGCGGGGCGGGGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 25, 3: 235, 4: 1458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!