ID: 969301550_969301553

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 969301550 969301553
Species Human (GRCh38) Human (GRCh38)
Location 4:6300201-6300223 4:6300229-6300251
Sequence CCTTCATGGAGGCTCAGGGAGGT CCTTGCTGTAGTGCAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 243} {0: 1, 1: 1, 2: 1, 3: 17, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!