ID: 969310223_969310233

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 969310223 969310233
Species Human (GRCh38) Human (GRCh38)
Location 4:6348604-6348626 4:6348650-6348672
Sequence CCTCGGCTCTGATCTGTGCTCTC GAAAAGGCTGGGATGCAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!