ID: 969311254_969311265

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 969311254 969311265
Species Human (GRCh38) Human (GRCh38)
Location 4:6354085-6354107 4:6354123-6354145
Sequence CCATCTGAACCCCTTGCGCTCTG CATCAGCATCTCTGTCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115} {0: 1, 1: 0, 2: 3, 3: 34, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!