ID: 969325704_969325709

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 969325704 969325709
Species Human (GRCh38) Human (GRCh38)
Location 4:6442644-6442666 4:6442675-6442697
Sequence CCGTGTTTTATATGAATTAACTC TCCAACACCCCTAGGGTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 374} {0: 1, 1: 0, 2: 2, 3: 14, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!