ID: 969326507_969326515

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 969326507 969326515
Species Human (GRCh38) Human (GRCh38)
Location 4:6447402-6447424 4:6447426-6447448
Sequence CCCTGCGGAGGAAGAGCTCCGGA AAATGTGAGGGAGGAAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 79} {0: 1, 1: 0, 2: 5, 3: 115, 4: 1214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!