ID: 969330340_969330350

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 969330340 969330350
Species Human (GRCh38) Human (GRCh38)
Location 4:6470988-6471010 4:6471025-6471047
Sequence CCTCCGCGGGGCTCCGGCTCCGC GGCAGAGCCAGGCTTCGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 269} {0: 1, 1: 1, 2: 3, 3: 31, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!