ID: 969354489_969354495

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 969354489 969354495
Species Human (GRCh38) Human (GRCh38)
Location 4:6617432-6617454 4:6617468-6617490
Sequence CCACCTATATGAAGTGGGCGAGG TCAGCCAGTGACAGTGAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46} {0: 1, 1: 0, 2: 1, 3: 20, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!