ID: 969371041_969371050

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 969371041 969371050
Species Human (GRCh38) Human (GRCh38)
Location 4:6731836-6731858 4:6731878-6731900
Sequence CCTTCTGCAGAGGGGGTACCCTG ATCAAGAGACGGGGATGGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!