ID: 969392752_969392763

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 969392752 969392763
Species Human (GRCh38) Human (GRCh38)
Location 4:6902017-6902039 4:6902057-6902079
Sequence CCATGAGATCTGAGAACAGCCAG GACAGGCCGCCGTGGGGCTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 36, 4: 640}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!