ID: 969414336_969414339

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 969414336 969414339
Species Human (GRCh38) Human (GRCh38)
Location 4:7048813-7048835 4:7048847-7048869
Sequence CCTGCAGGATTTGTCCTTTTCTG TCACTTTGCCTCATGTCGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 82, 4: 402} {0: 1, 1: 0, 2: 2, 3: 22, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!