ID: 969435395_969435411

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 969435395 969435411
Species Human (GRCh38) Human (GRCh38)
Location 4:7186340-7186362 4:7186386-7186408
Sequence CCTGGCTTCCAAGTGCCTGCCAC CAGAGGACGCTGGGCAGACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!