ID: 969443921_969443929

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 969443921 969443929
Species Human (GRCh38) Human (GRCh38)
Location 4:7233454-7233476 4:7233496-7233518
Sequence CCGGACACTGGGCCACAGTGCAG CAGGGTGAGCAGACACTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 273} {0: 1, 1: 0, 2: 2, 3: 28, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!