ID: 969454595_969454604

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 969454595 969454604
Species Human (GRCh38) Human (GRCh38)
Location 4:7294215-7294237 4:7294241-7294263
Sequence CCGGGGCGTAGGGGAGAGGAGGG CTGTGGGCAGATTTGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 545} {0: 1, 1: 0, 2: 7, 3: 49, 4: 701}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!