ID: 969460226_969460246

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 969460226 969460246
Species Human (GRCh38) Human (GRCh38)
Location 4:7325118-7325140 4:7325169-7325191
Sequence CCCCAGGCCCCCTTGGGTGGGGC GGTGCAGGGCACTGGGGAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 53, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!