ID: 969462535_969462553

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 969462535 969462553
Species Human (GRCh38) Human (GRCh38)
Location 4:7336367-7336389 4:7336406-7336428
Sequence CCCAGAGACCCCCAACTCCCCGG CTGAGATCAATGCGAACAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 30, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!