ID: 969463926_969463938

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 969463926 969463938
Species Human (GRCh38) Human (GRCh38)
Location 4:7343685-7343707 4:7343737-7343759
Sequence CCCTTAGGAGGTCAAGAGGAAGC CCACCTAGTGTTGAGTGGGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!