ID: 969468879_969468897

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 969468879 969468897
Species Human (GRCh38) Human (GRCh38)
Location 4:7374775-7374797 4:7374817-7374839
Sequence CCTGGCCCCACAGCCATCTTGTG CTGGGTAGACCGCGGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 305} {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!