ID: 969469183_969469195

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 969469183 969469195
Species Human (GRCh38) Human (GRCh38)
Location 4:7376912-7376934 4:7376965-7376987
Sequence CCACGGATGTTCCAGCCCCAGTG CTGAAGACCGGCTCTGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!