ID: 969469184_969469195

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 969469184 969469195
Species Human (GRCh38) Human (GRCh38)
Location 4:7376923-7376945 4:7376965-7376987
Sequence CCAGCCCCAGTGCACAAACCCTG CTGAAGACCGGCTCTGCACTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 24, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!