ID: 969469188_969469196

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 969469188 969469196
Species Human (GRCh38) Human (GRCh38)
Location 4:7376929-7376951 4:7376971-7376993
Sequence CCAGTGCACAAACCCTGGCCTGC ACCGGCTCTGCACTGGGATTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!