ID: 969471419_969471426

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 969471419 969471426
Species Human (GRCh38) Human (GRCh38)
Location 4:7391551-7391573 4:7391576-7391598
Sequence CCAGGAACTGAGTGTGGACTTCA GTTCTTTTCCTTCTGGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 180} {0: 1, 1: 0, 2: 5, 3: 32, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!