ID: 969475351_969475356

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 969475351 969475356
Species Human (GRCh38) Human (GRCh38)
Location 4:7419398-7419420 4:7419424-7419446
Sequence CCTTGGTGAGAGACACATGGCCA CTCAGGTTACAGAGAAAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 167} {0: 1, 1: 0, 2: 2, 3: 21, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!