ID: 969482992_969483002

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 969482992 969483002
Species Human (GRCh38) Human (GRCh38)
Location 4:7456762-7456784 4:7456800-7456822
Sequence CCCCTGTGGCAGGGGTAGGGGGG CGACGATCAGTGTGGAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 487} {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!