ID: 969482995_969483003

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 969482995 969483003
Species Human (GRCh38) Human (GRCh38)
Location 4:7456764-7456786 4:7456808-7456830
Sequence CCTGTGGCAGGGGTAGGGGGGTG AGTGTGGAGGGAAGGATCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 591} {0: 1, 1: 0, 2: 2, 3: 25, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!