ID: 969486764_969486773

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 969486764 969486773
Species Human (GRCh38) Human (GRCh38)
Location 4:7476688-7476710 4:7476730-7476752
Sequence CCTGCTAGGAGTCCCTCTCCAAT CACCTCTCTAAGCAGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111} {0: 1, 1: 0, 2: 1, 3: 10, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!