ID: 969492791_969492806

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 969492791 969492806
Species Human (GRCh38) Human (GRCh38)
Location 4:7509603-7509625 4:7509651-7509673
Sequence CCCACAGGGGGCTGGGGTGAACC CGAGGAAGGCCACGTAGAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!