ID: 969512985_969512997

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 969512985 969512997
Species Human (GRCh38) Human (GRCh38)
Location 4:7630171-7630193 4:7630224-7630246
Sequence CCTCTGGGACCTGGACACAGCCC CCATGTCCACAGGTGAGGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 23, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!