ID: 969517628_969517638

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 969517628 969517638
Species Human (GRCh38) Human (GRCh38)
Location 4:7656448-7656470 4:7656498-7656520
Sequence CCCATGCGGGTCTCCCTCATGTC CATTCTAGGTCTCATGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67} {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!